Maple Brain Lab · DOGMA

Intelligence without transformer self-attention

DOGMA is the DNA-Organized Genomic Model Architecture: a trainable network built from local structural cells, explicit regulation, recurrent mixing, bounded memory, and expression. The architecture is implemented; its ambitious hypotheses remain open research questions.

Canonical Definition

DOGMA is non-transformer by contract

The canonical path contains no transformer block, no dot-product self-attention, and no global token-to-token attention matrix. Optional attention experiments are excluded from canonical DOGMA checkpoints and must be reported as ablations. Sequence communication comes from overlapping local cells, causal convolutions, selective state, sparse allosteric routing, and bounded recurrent memory.

Plain-language animation

How DOGMA computes, without the biology mystique

Follow one sequence through the implemented native path. The names come from biology; every step below is an ordinary, inspectable tensor operation.

Input bytes
DNA·learns
CCATCCTCCGACCTTA
Base-4 is reversible notation, not meaning by itself.
Expression
i38%
s27%
e19%
DNA learns i...Score, choose, append, repeat.
01

Turn symbols into state

A symbol becomes more than a letter

DOGMA starts with bytes, just like a small byte-level language model. Each byte receives a learned symbol vector, an inferred type, a regulatory weight, and a compatibility value. A/T/C/G can expose the state in base-4 form, but the neural computation uses continuous tensors.

Everyday version: Write each input on a richer index card.

Scientific verdict

Is the fundamental idea sound?

Yes as a falsifiable sequence-model research program. No as a claim that biological metaphor alone produces intelligence, or that DOGMA already works better than transformers.

Sound foundation

Non-attention sequence models are a legitimate direction

Convolutional and selective state-space architectures already show that useful language and genomic models do not require dense self-attention. DOGMA belongs in that research family.

Testable hypothesis

Local cells, gates, memory, and expression form a coherent model

Each component is differentiable, trainable, and removable in an ablation. That makes the architecture scientifically testable instead of merely metaphorical.

Weakest assumption

Biological names do not create a computational advantage

A/T/C/G encoding is base-4 storage, and a four-position cell is not automatically better because it is called tetra memory. Random-code and ordinary gated-convolution controls must test those choices.

Current verdict

Promising research program, not a transformer replacement yet

Native DOGMA has not produced reliable language or beaten a matched baseline. The hybrid can answer narrow prompts because a small transformer adapter realizes the prose.

Measured Hybrid Sample

Watch one request cross the genomic boundary

This is a replay of a held-out evaluation, not simulated typing. The bootstrap compiler emits a canonical 64-base trace; a compact realization adapter produces the answer.

01

Request

Generate a canonical ATCG semantic trace, then explain what canonical means.

02 · 64 bases

ATCG trace

ATGATGCCCGTGCGCCCTAGCGACCTCACGCCAGAACGACAGAACGATCGACCGTGTAATAAAT
03 · audited transcript

Transcript

Generate a canonical ATCG se

04 · held-out answer

Natural language

Canonical refers to a standardized, consistent sequence of A/T/C/G in DNA/RNA strands, ensuring uniformity in molecular structure and function. It defines expected patterns in genetic sequences, enabling accurate comparison and analysis across different biological contexts.

Native DOGMACycle 101 · rejected29.8M parameters; malformed generation was not promoted.
Hybrid bridge4/4 held-out probes passedDeterministic ATCG compiler + 0.6B LoRA realization layer.
Scientific boundaryBridge validated, hypothesis openThe trace is not yet proven to improve language over a matched baseline.

Computational Path

From genotype-like state to expressed output

These names are computational analogies with explicit operators. They do not assert that a neural network reproduces cellular biology.

01

Genomic embedding

Each token becomes a typed base state with symbol, inferred role, regulatory weight, and compatibility potential. This is learned representation, not a claim that text is literal biology.

02

Tetra memory

Overlapping local cells compute pairwise bonds and propagate state through shared faces. The implemented path uses local structured interaction rather than global dot-product self-attention.

03

Regulation

Learned gates suppress, preserve, or amplify regions before expression. This creates an explicit control stage inside every block.

04

Transcription

Causal convolutions and optional state-space recurrence move information across regions with sub-quadratic sequence mixing.

05

Epigenetic state

A bounded recurrent memory records durable context across computation. The research question is whether state can support adaptation without a transformer KV cache.

06

Expression

A bottleneck folds internal state into a phenotype-like representation, then a realization head produces the observable output.

DOGMA and transformers

Where DOGMA could be better, and where it is not

The useful comparison is not biology versus machinery. It is one set of sequence operators against another under equal data, parameters, training compute, and hardware.

QuestionTransformerDOGMAEvidence today
How does context move?

Every token can directly score every earlier token through self-attention.

Fixed local windows, causal convolution, and optional recurrent state propagate information.

Different, both valid
Sequence scaling

Standard dense attention builds a quadratic token-pair matrix.

Fixed-window and fixed-state interaction can grow linearly with sequence length.

DOGMA hypothesis
Exact distant recall

Strong content-addressed retrieval and a mature KV-cache ecosystem.

Information must survive repeated propagation or bounded memory.

Transformer leads
Natural language today

Demonstrated across large, diverse corpora and many scales.

Current native checkpoint fails all frozen language probes.

Transformer leads
DNA-specific structure

Can learn DNA tasks; specialist models add tokenization and invariance.

Could encode regulation and locality directly, but lacks evidence of an advantage.

Open experiment

Measured Baseline

Cycle 101 confirms that perplexity is not capability

The current native baseline has 29,830,396 parameters and no transformer layers. Its test perplexity is 1.1216, yet its free generation failed the ATCG boundary, explanation, critique, general-language, and prompt-diversity probes. The candidate is rejected. Its roughly 134 KB training split is far too small to support a broad language claim, and its much easier test distribution makes the low perplexity unsuitable for comparison with public language models. The passing hybrid above is tracked separately.

CycleValid PPLTest PPLDecisionObserved generation
62.73671.4083Promoted under the legacy gate

Produced a structured DNA-like run and fragments of text, but weak prose.

112.78751.3867Rejected

Lower test perplexity coincided with binary-looking output.

132.73591.3931Rejected

Some structured DNA output appeared; explanatory text remained poor.

142.67591.3791Rejected

Best likelihood in this snapshot, but unreadable generation exposed the old gate.

312.41831.1181Rejected

Lowest likelihood snapshot, but malformed genomic syntax and prompt-invariant fragments failed every generation probe.

322.48411.1340Rejected

A faster local step regressed likelihood slightly and still failed every ATCG-first language probe.

332.49471.1451Rejected

The evidence-directed 160-to-80-base trace mutation did not repair the ATCG boundary or language probes.

1002.42521.1191Rejected

More real-data anchors preserved likelihood, but native output remained malformed and failed all frozen language probes.

V2 Correction

One score no longer decides deployment

  1. Bind every result to the exact evaluated checkpoint and parent lineage.
  2. Reserve at least 65% of sampling mass for audited real-data anchors.
  3. Run DNA validity, readable explanation, and self-critique probes under two fixed seeds.
  4. Archive diverse stepping stones, but promote only a global objective improvement with no hard failure.

External models

Real genome data, native DOGMA weights

DNABERT-2: benchmark, representation teacher, or frozen-feature ablation only.

Med-BERT: excluded; structured EHR event codes are not nucleotide sequences.

Qwen realization: a separately reported language bridge, never native DOGMA evidence.

Read the executable model contract

Research Hypotheses

Each architectural idea carries its own way to fail

H1

Local structure can scale

Overlapping cells plus recurrent propagation should recover long-range dependencies without dense all-pairs attention.

Falsifier: DOGMA fails length extrapolation after matching parameter count, data, and compute against convolutional, state-space, and transformer baselines.
H2

Regulation improves sparse credit

Explicit suppress/amplify gates should improve compositional tasks where only a small subset of the sequence controls the answer.

Falsifier: Removing regulation does not reduce calibrated accuracy, sample efficiency, or attribution quality on preregistered sparse-signal tasks.
H3

Expression bottlenecks aid transfer

Separating internal genotype-like state from an expressed phenotype may produce reusable representations across modalities and tasks.

Falsifier: The bottleneck consistently harms transfer or collapses representation diversity relative to a capacity-matched residual head.
H4

Bounded state supports adaptation

Epigenetic memory should preserve task-relevant state and adapt over long horizons without unbounded context replay.

Falsifier: State cannot beat a fixed-window baseline on delayed recall, non-stationary rules, and continual-learning tests without unacceptable forgetting.

Primary literature

The ideas DOGMA must answer to

These are foundations and external baselines, not endorsements of DOGMA. They define the standard of evidence for molecular computing, language modeling, long context, genomics, and recursive learning.

Evidence Ledger

Code, experiments, and aspiration are different states

Implemented

  • Byte-level genomic embedding with learned type and regulatory channels
  • Overlapping tetra-memory cells with causal local propagation
  • Explicit regulation gates and convolutional transcript mixing
  • Expression bottleneck, autoregressive realization head, checkpoints, and quality-gated service

Experimental

  • Multi-scale tetra cells, DNA-compute logic, chemical-reaction layers, and parallel-scan state
  • Epigenetic memory, allosteric routing, codon translation, and multimodal tetra meshes
  • Recursive curriculum memory and bounded architecture mutations
  • Rust inference parity for the canonical non-attention path

Not established

  • No evidence yet that DOGMA beats strong transformers or state-space baselines at matched compute
  • No demonstrated open-ended self-improvement
  • No AGI claim and no claim of biological equivalence
  • No result is accepted without held-out evaluation and reproducible checkpoints

Evaluation Program

Matched-compute baselines before scale

The first objective is not a giant checkpoint. It is identifying which DOGMA components survive controlled comparison and ablation.

TrackPrimary evidenceControls
Sequence modeling

Bits per byte, perplexity, length extrapolation, throughput, peak memory

Transformer, Hyena, Mamba, convolutional LM; matched tokens, parameters, and training FLOPs

Structured composition

Exact match on unseen rule compositions, graph reachability, algorithmic depth

Randomized train/test grammars and longer-than-training sequences

State and plasticity

Delayed recall, rule-switch adaptation, backward transfer, forgetting

Frozen-window, recurrent, and external-memory baselines

Genomic transfer

Reverse-complement consistency, motif recovery, species-held-out transfer

DNABERT-2, HyenaDNA, and Caduceus where task and licensing permit