Maple Brain Lab · DNA Research

Two paths toward DNA-native intelligence

DOGMA and Hermon DNA are separate research programs. DOGMA asks whether regulated local computation can replace the transformer. Hermon DNA asks how far genome-native encoders can learn transferable biological sequence representations. Neither project claims AGI; both publish the evidence required to move toward it.

Start Here

From DNA to AGI, second-edition research preview

A 509-page undergraduate guide connects molecular biology, DNA computing, machine learning, the canonical non-transformer DOGMA architecture, recursive evaluation, laboratories, and open research questions.

509 pages19 chapters12-week courseEvidence-labeled claims

Measured DOGMA

Cycle 101
DecisionRejected by evidence gate
Test perplexity1.1216
Generation probesNot passed
Inspect evidence

Measured Hybrid Sample

Watch one request cross the genomic boundary

This is a replay of a held-out evaluation, not simulated typing. The bootstrap compiler emits a canonical 64-base trace; a compact realization adapter produces the answer.

01

Request

Generate a canonical ATCG semantic trace, then explain what canonical means.

02 · 64 bases

ATCG trace

ATGATGCCCGTGCGCCCTAGCGACCTCACGCCAGAACGACAGAACGATCGACCGTGTAATAAAT
03 · audited transcript

Transcript

Generate a canonical ATCG se

04 · held-out answer

Natural language

Canonical refers to a standardized, consistent sequence of A/T/C/G in DNA/RNA strands, ensuring uniformity in molecular structure and function. It defines expected patterns in genetic sequences, enabling accurate comparison and analysis across different biological contexts.

Native DOGMACycle 101 · rejected29.8M parameters; malformed generation was not promoted.
Hybrid bridge4/4 held-out probes passedDeterministic ATCG compiler + 0.6B LoRA realization layer.
Scientific boundaryBridge validated, hypothesis openThe trace is not yet proven to improve language over a matched baseline.

Non-transformer genomic computation network

DOGMA

Can intelligence emerge from regulated local structure, persistent state, and expression instead of self-attention?

Substrate
Byte and nucleotide sequences
Learning
Autoregressive modeling, structural objectives, curriculum evolution, and gated architecture search
Evidence state
Latest 29.8M native candidate rejected; transformer realization bridge passes 4/4 narrow held-out probes
Open research program

DNA encoder and transformer research line

Hermon DNA

How far can genome-native representations support reliable sequence understanding and scientific reasoning?

Substrate
Nucleotide sequences, annotations, tasks, and retrieved evidence
Learning
Masked sequence modeling, supervised task heads, contrastive objectives, and instruction adaptation
Evidence state
DNABERT-2 classifier path implemented; broader foundation evaluation in progress
Open research program

The Boundary

DNA-inspired is not the same as a DNA language model

DOGMA borrows organization principles such as local structure, regulation, persistent marks, transcription, and expression to define a new computational architecture. Its primary benchmark substrate can be text, code, symbolic sequences, or genomic data.

Hermon DNA models actual nucleotide sequences and scientific tasks. Its architecture is allowed to use transformers, bidirectional encoders, state-space models, and retrieval. The biology is in the data and evaluation target, not in a metaphor for the network.

Developer Guide

DNABERT-2 is useful. Med-BERT is a different modality.

DOGMA stays native and non-transformer; DNABERT-2 is its external genomic baseline. Hermon DNA uses DNABERT-2 in the nucleotide lane, a separate instruction model for explanations, and no Med-BERT unless a governed EHR research lane is explicitly enabled.

Open model guide

Research Ladder

DNA-base AGI is a sequence of falsifiable milestones

The phrase is a research direction, not a product claim. Progress means clearing increasingly difficult evidence gates while retaining prior capability, calibration, and diversity.

01

Representation

Learn compact sequence states that transfer across tasks and lengths.

Linear probes, retrieval, reverse-complement consistency, out-of-distribution transfer.
02

Dynamics

Maintain and revise latent state under changing rules and delayed consequences.

Long-horizon recall, rule switches, counterfactual interventions, causal ablations.
03

Composition

Build reusable programs from local operators, memory, and conditional expression.

Systematic generalization to unseen combinations and lengths.
04

Recursive improvement

Turn diagnosed failures into better curricula or bounded architecture proposals.

Multi-cycle improvement against frozen suites without loss of diversity or prior skills.
05

Open-ended agency

Form hypotheses, select experiments, and revise models under explicit resource and safety constraints.

Independent replication on new environments; no AGI claim before this evidence exists.

Recursive Learning

Self-improvement must be earned by independent evidence

Every cycle starts from measured failures, trains an isolated candidate, and ends at a frozen evaluation gate. Real-data anchors remain in the corpus; synthetic data is provenance-labeled and capped.

Read the protocol

Primary Literature

Research foundations and competing baselines

These papers are references and baselines, not evidence that MapleAI has reproduced their results.