{
  "architecture": "DNA-Organized Genomic Model Architecture",
  "architecture_contract": {
    "communication": [
      "overlapping_tetra_memory",
      "causal_transcript_convolution",
      "parallel_scan_state_space"
    ],
    "contract": "canonical_non_transformer_dogma",
    "failures": [],
    "model_kind": "dogmaforge",
    "passed": true,
    "schema_version": 1,
    "self_attention": false,
    "transformer_layers": 0
  },
  "cycle": 101,
  "lineage": {
    "candidate_run": "evo_trainer_cycle_101",
    "mutation": {
      "candidate_value": 0.8125,
      "field": "corpus.minimum_real_anchor_sampling_fraction",
      "parent_value": 0.65,
      "rationale": "increase real genomic anchors after simpler sampling did not repair syntax"
    },
    "operator": "evidence_directed_single_variable_mutation",
    "parent_recorded": true,
    "probe_suite": "dogma-genomic-language-v3",
    "schema_version": 1
  },
  "model_family": "DOGMA",
  "product": "Evo Trainer",
  "quality_gate": {
    "architecture_contract": {
      "communication": [
        "overlapping_tetra_memory",
        "causal_transcript_convolution",
        "parallel_scan_state_space"
      ],
      "contract": "canonical_non_transformer_dogma",
      "failures": [],
      "model_kind": "dogmaforge",
      "passed": true,
      "schema_version": 1,
      "self_attention": false,
      "transformer_layers": 0
    },
    "checkpoint_present": true,
    "finite_metrics": true,
    "max_test_perplexity": 220.0,
    "objective": 6.22878068,
    "objective_improved": true,
    "parameter_count": 29830396,
    "passed": false,
    "previous_best_test_perplexity": null,
    "previous_best_valid_perplexity": null,
    "probe_suite": {
      "atcg_first_contract": {
        "passed": false
      },
      "dna_sequence": {
        "minimum_canonical_run": 0,
        "passed": false
      },
      "explanation": {
        "passed": false
      },
      "general_nlp": {
        "passed": false
      },
      "passed": false,
      "reproduction_seeds": [
        17,
        29
      ],
      "self_critique": {
        "passed": false
      },
      "suite": "dogma-genomic-language-v3"
    },
    "recursive_preflight": {
      "contract": "recursive_learning_preflight",
      "critical_regressions": 0,
      "data": {
        "real_anchor_examples": 18,
        "real_anchor_fraction": 0.8125,
        "real_anchor_sampling_fraction": 0.8125,
        "synthetic_examples": 19,
        "synthetic_fraction": 0.1875,
        "train_eval_overlap": 0
      },
      "failures": [],
      "lineage": {
        "candidate_recorded": true,
        "eval_suite_version": "dogma-genomic-language-v3",
        "parent_recorded": true,
        "reproduction_seeds": [
          17,
          29
        ]
      },
      "passed": true,
      "policy": {
        "maximum_critical_regressions": 0,
        "maximum_synthetic_fraction": 0.35,
        "minimum_real_anchor_fraction": 0.65,
        "minimum_reproduction_seeds": 2,
        "require_distinct_parent": true,
        "require_frozen_eval_suite": true
      },
      "schema_version": 1
    },
    "regression_limit_passed": true,
    "test_perplexity": 1.1215827484305207,
    "valid_perplexity": 2.428791720338811,
    "valid_regression_limit_passed": true
  },
  "recursive_preflight": {
    "contract": "recursive_learning_preflight",
    "critical_regressions": 0,
    "data": {
      "real_anchor_examples": 18,
      "real_anchor_fraction": 0.8125,
      "real_anchor_sampling_fraction": 0.8125,
      "synthetic_examples": 19,
      "synthetic_fraction": 0.1875,
      "train_eval_overlap": 0
    },
    "failures": [],
    "lineage": {
      "candidate_recorded": true,
      "eval_suite_version": "dogma-genomic-language-v3",
      "parent_recorded": true,
      "reproduction_seeds": [
        17,
        29
      ]
    },
    "passed": true,
    "policy": {
      "maximum_critical_regressions": 0,
      "maximum_synthetic_fraction": 0.35,
      "minimum_real_anchor_fraction": 0.65,
      "minimum_reproduction_seeds": 2,
      "require_distinct_parent": true,
      "require_frozen_eval_suite": true
    },
    "schema_version": 1
  },
  "sample": "",
  "service": "research_preview",
  "status": "rejected",
  "updated_at_unix": 1785392332,
  "hybrid": {
    "adapter": "dogma-realizer-qwen3-0.6b-lora-v001",
    "architecture": "DOGMA ATCG substrate + Qwen3 realization adapter",
    "atcg_first": true,
    "model_family": "DOGMA",
    "natural_language_gate": true,
    "probe_suite": "dogma-genomic-language-v3",
    "product": "Evo Trainer",
    "quality_gate": {
      "atcg_first_contract": {
        "genome_precedes_answer": true,
        "passed": true,
        "traces": {
          "dna_sequence": {
            "canonical_fraction": 1.0,
            "length": 64,
            "passed": true,
            "transcript_words": 4
          },
          "explanation": {
            "canonical_fraction": 1.0,
            "length": 64,
            "passed": true,
            "transcript_words": 4
          },
          "general_nlp": {
            "canonical_fraction": 1.0,
            "length": 64,
            "passed": true,
            "transcript_words": 4
          },
          "self_critique": {
            "canonical_fraction": 1.0,
            "length": 64,
            "passed": true,
            "transcript_words": 4
          }
        }
      },
      "distinct_answers": {
        "count": 4,
        "passed": true
      },
      "dna_sequence": {
        "canonical_letter_fraction": 1.0,
        "longest_canonical_run": 64,
        "passed": true
      },
      "explanation": {
        "alphabetic_words": 22,
        "lexical_diversity": 0.863636,
        "passed": true,
        "printable_fraction": 1.0,
        "replacement_characters": 0
      },
      "general_nlp": {
        "alphabetic_words": 20,
        "lexical_diversity": 0.75,
        "passed": true,
        "printable_fraction": 1.0,
        "replacement_characters": 0
      },
      "passed": true,
      "self_critique": {
        "alphabetic_words": 16,
        "lexical_diversity": 0.9375,
        "passed": true,
        "printable_fraction": 1.0,
        "replacement_characters": 0
      },
      "suite": "dogma-genomic-language-v3"
    },
    "realization_contract": {
      "compiler": "deterministic_bootstrap",
      "genome_length": 64,
      "language_layer": "transformer_lora_adapter",
      "native_generator_used": false
    },
    "sample_cases": [
      {
        "answer": "Canonical refers to a standardized, consistent sequence of A/T/C/G in DNA/RNA strands, ensuring uniformity in molecular structure and function. It defines expected patterns in genetic sequences, enabling accurate comparison and analysis across different biological contexts.",
        "genome": "ATGATGCCCGTGCGCCCTAGCGACCTCACGCCAGAACGACAGAACGATCGACCGTGTAATAAAT",
        "id": "dna_sequence",
        "passed": true,
        "prompt": "Generate a canonical ATCG semantic trace, then explain what canonical means.",
        "transcript": "Generate a canonical ATCG se"
      },
      {
        "answer": "From DNA to RNA, the intermediate is messenger RNA (mRNA). This step transfers genetic code from genes to proteins in cellular processes.",
        "genome": "ATGATGAGCGACCGATCGCCAGAACGGCCGTGCGCGCGTTCTAGCGTCCGACCTCATAATAAAT",
        "id": "explanation",
        "passed": true,
        "prompt": "Trace information from a gene to a protein and name the intermediate molecular step.",
        "transcript": "Trace information from a gen"
      },
      {
        "answer": "Low perplexity indicates confidence, but incoherence suggests uncertainty. A falsifiable test could assess response consistency under uncertainty.",
        "genome": "ATGATGAACGTCCGTTCGCACGCCCGTAAGAACGGACGACCTATAGAACGTACGTTTAATAAAT",
        "id": "self_critique",
        "passed": true,
        "prompt": "A model has low perplexity but gives incoherent answers. Name one plausible limitation and one falsifiable test.",
        "transcript": "A model has low perplexity b"
      },
      {
        "answer": "The hypothesis is the untested explanation or theory. The evidence is observable data or experiments that support or contradict it.",
        "genome": "ATGATGAACTATCTCACTCCCGCACTGCAGAACTAACTAGCGTTCTAACGTTCTATTAATAAAT",
        "id": "general_nlp",
        "passed": true,
        "prompt": "A study proposes an explanation and then collects measurements. Distinguish the hypothesis from the evidence.",
        "transcript": "A study proposes an explanat"
      }
    ],
    "schema_version": 1,
    "status": "validated",
    "teacher_model": "Qwen/Qwen3-4B-Instruct-2507",
    "updated_at_unix": 1785392338
  },
  "automation": {
    "mode": "evaluation_gated_recursive_training",
    "quiet_period_seconds": 1800,
    "schedule": [
      "Hermon",
      "DOGMA",
      "DOGMA"
    ],
    "promotion_policy": "frozen probes must pass before promotion",
    "machine_details_public": false
  }
}